6.5 million Americans are living with Alzheimer's disease - a brain disorder that destroys memory and the ability to think. It's the most common cause of dementia in older adults.
Learn more: http://ow.ly/43yS50OCwqv#alzheimers
There is no test yet to predict late-onset Alzheimer's, symptoms become apparent in a person’s mid-60s.
There is a test to learn if you have one of three genetic variants associated with early-onset, which occurs in the 30s - mid-60s.
http://ow.ly/Jrhj50OCwUc#alzheimers
Alzheimer's disease is diagnosed using several methods and tools:
• noting personality & behavior changes
• tests of memory and cognitive skills
• measuring protein levels associated with Alzheimer’s and related dementias
• brain scans
http://ow.ly/lfeW50OCwGZ#alzheimers
Cognitive testing checks certain brain functions, including thinking, learning, remembering, and using judgment and language. Problems with these functions are called cognitive impairment. Learn more: http://ow.ly/gWmy50OCpKH#MildCognitiveImpairment#CognitiveTesting
High blood pressure can be checked, lowered and controlled. To keep yours in a healthy range:
🥗 Eat a healthy diet
🧂 Lower salt intake
🚶 Move more
⚖️ Maintain a healthy weight
😌 Manage stress
🚭 Don’t smoke
💊 Take prescribed meds
🍷 Limit alcohol
#StrokeMonth
Everyone can play a role in suicide prevention. Some warning signs may help you determine if a young person in your life is at risk for suicide.
Know the warning signs
Seek help by calling @988Lifeline#MentalHealthMonth
Gastroesophageal reflux disease (GERD) happens when the stomach contents leak backward from the stomach into the esophagus. GERD can irritate the esophagus and cause heartburn and other symptoms. Lifestyle changes and medications can treat it. http://ow.ly/wQuf50OAal2
Generalized anxiety disorder (GAD) is a mental disorder in which a person is often worried or upset and finds it hard to control this anxiety. The cause of GAD is unknown. Genes may play a role. Stress may also contribute to the development of GAD. http://ow.ly/2tFT50OA893
May is #MentalHealthMonth. Some stress we can't control, but we can work on our sleep habits. Getting enough quality sleep at the right times can help protect your mental and heart health. https://bit.ly/3Wssofi
Ehlers-Danlos syndrome (EDS) impairs collagen production, weakening the connective tissues that support the skin, bones, blood vessels, and many other organs and tissues. It can cause loose joints, fragile skin, and bleeding problems. Learn more: http://ow.ly/uq5Z50OzKgg
What do your blood pressure numbers mean? Healthy blood pressure is less than 120/80 mm Hg. High blood pressure occurs when blood pressure is consistently 130/80 mm Hg or higher. Learn more:https://bit.ly/3Vy6tUf#HighBloodPressureMonth
Understanding the basics of genetics empowers us to make informed decisions about our health and embrace genetic testing and therapy for precision care. Knowledge is power! http://ow.ly/CXli50OztIq#MedlinePlusGenetics
ADHD stands for attention deficit hyperactivity disorder. A person with ADHD has differences in brain development and brain activity that affect attention, the ability to sit still, and self-control. Learn more: http://ow.ly/FMMT50OtkNV
Memorial Day honors America's military men and women who lost their lives in service to their country. Americans reflect on the sacrifice of these heroes who perished while serving in our Armed Forces.
http://ow.ly/hnkz50OyASe#memorialday
Mental disorders are serious conditions which can affect your thinking, mood, and behavior. Mental health is important because it can raise your risk for stroke, type 2 diabetes, and heart disease. Learn more: http://ow.ly/V5Wy50Otj8B
Making sure you hold your body the right way, whether moving or still, can prevent pain, injuries, and other health problems. Learn more about how posture can affect your health and how to improve your posture when sitting or standing. http://ow.ly/RUb650Ox7EV#GoodPosture
Certain fears are normal during childhood. A child’s fear can be a natural reaction to feeling unsure and vulnerable. Some kids are more sensitive to fears and may struggle to overcome them. Learn more about #childhoodfear: http://ow.ly/JYOS50Ox7nq#NothingToFearDay
Bronchiectasis is a condition that occurs when the airway tubes carrying air in and out of the lungs become damaged. The airways slowly lose their ability to clear out mucus, leading to complications. Learn more: http://ow.ly/8RpM50Ox6PR#LungDisease#Bronchiectasis
If your power is out and you use medical equipment that requires electricity, ask your power provider for priority power restoration.
In the meantime, use a generator or relocate to a shelter or medical facility.
Power outage tips: http://ready.gov/power-outages#Mawar
It’s normal for a baby to reflux (spit up) milk or food. This is known as GER (Gastroesophageal Reflux). More serious, longer-lasting symptoms are called GERD (Gastroesophageal Reflux Disease). Learn more: http://ow.ly/wuQE50Ox6qj#Infant#GastricReflux#GastroesophagealReflux
When it comes to #stroke, don’t delay—call the ambulance right away! Know these stroke signs and symptoms; you might help save a life. #StrokeMonth#EMSWeek
These Turkey Ginger Rice Lettuce Wraps combine a flavorful sauce with meat, rice and crunchy vegetables for a perfect quick dinner or appetizer. These wraps are a great source of protein and vitamin A. http://ow.ly/34rg50OwboJ#HealthyRecipe#LettuceWraps
A Bacteria Culture Test can help find harmful bacteria that may make you sick. You will need to give a sample of your blood, urine, skin, or other tissue for the test, depending on the location of the infection. Learn more: http://ow.ly/jS0U50Owbk7#BacteriaCultureTest
La Crosse encephalitis is rare, but deadly. It occurs most often in children younger than 16 years old. Keep your family safe by using EPA-registered insect repellent and removing standing water near your home where mosquitoes lay eggs.
Learn more: https://bit.ly/3VOEr7j
Men, are you at risk for prostate cancer?
•African American
•over age 60
•have a father or brother with prostate cancer
•eat a diet high in fat, especially animal fat
•obese
Learn more about diagnosis and treatments: http://ow.ly/Krxg50OuUmf
This month during National High Blood Pressure Education Month, be sure to pay attention to YOU! Your risk for high blood pressure goes up as you age. Two out of every 3 women 60 and older have high blood pressure. http://bit.ly/3MCTAG0
Do you know where you can #GetTested for #HIV? Use our HIV Services Locator to find testing sites—and other support services—in a location that works for YOU. Visit http://locator.HIV.gov.
Night blindness may cause problems with driving at night. People with night blindness often have trouble seeing stars on a clear night or walking through a dark room, such as a movie theater. Learn more: http://ow.ly/yVTz50OuTQL
Tag, you’re it! Activities such as chase, hide-and-seek, kickball, and duck, duck, goose are fun games to get young children involved in physical activity early. Encourage kids to #BeActive and stay active with these tips: https://bit.ly/3MIm9Sf. #MoveInMay#CDCChronic
Genetics can play a role in the severity of a person's reaction to Lyme disease, particularly whether they'll develop a complication called antibiotic-refractory Lyme arthritis.
To learn more about genetic factors in Lyme disease, check out http://ow.ly/JlKa50OtoLY
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
In the HTT gene, 3 DNA building blocks—CAG—are normally repeated 10 to 35 times. Just 1 more time can cause Huntington's disease. Read why: http://ow.ly/J25c50Otm8n
NHLBI offers free cookbooks of healthy recipes to get you started cooking healthy today! Check out their huge recipe collection: https://bit.ly/3ByloEZ#NWHW2023
Celiac disease is an immune disease in which people can't eat gluten because it will damage their small intestine. Gluten is a protein found in wheat, rye, and barley. Blood tests can help your doctor diagnose the disease. Learn more:
http://ow.ly/Tg8m50OlPmG