Opens profile photo
Follow
Click to Follow medlineplus
MedlinePlus.gov
@medlineplus
Official Twitter account of MedlinePlus at . Latest news & info on health & medicine. Privacy: go.usa.gov/x6k7C
Bethesda, MDmedlineplus.govJoined March 2009

MedlinePlus.gov’s Tweets

There is no test yet to predict late-onset Alzheimer's, symptoms become apparent in a person’s mid-60s. There is a test to learn if you have one of three genetic variants associated with early-onset, which occurs in the 30s - mid-60s. ow.ly/Jrhj50OCwUc #alzheimers
A diverse group of women.  Text overlay reads:  How do I know if I'm at risk for Alzheimer's disease?  genes, environment and lifestyle can offer clues.  The NIH and MedlinePlus logos.
3
Alzheimer's disease is diagnosed using several methods and tools: • noting personality & behavior changes • tests of memory and cognitive skills • measuring protein levels associated with Alzheimer’s and related dementias • brain scans ow.ly/lfeW50OCwGZ #alzheimers
A senior woman talking with a doctor.  Text overlay reads:  How is Alzheimer's disease diagnosed?  Noting personality & behavior changes. Tests of memory, problem solving, attention, counting, language. Measuring protein levels associated with Alzheimer’s & related dementias. Brain scans.  The NIH and MedlinePlus logos.
1
7
Gastroesophageal reflux disease (GERD) happens when the stomach contents leak backward from the stomach into the esophagus. GERD can irritate the esophagus and cause heartburn and other symptoms. Lifestyle changes and medications can treat it. ow.ly/wQuf50OAal2
Person pressing hand on their chest.
2
Generalized anxiety disorder (GAD) is a mental disorder in which a person is often worried or upset and finds it hard to control this anxiety. The cause of GAD is unknown. Genes may play a role. Stress may also contribute to the development of GAD. ow.ly/2tFT50OA893
Person sitting, leaning against a wall with hands covering the face.
3
Ehlers-Danlos syndrome (EDS) impairs collagen production, weakening the connective tissues that support the skin, bones, blood vessels, and many other organs and tissues. It can cause loose joints, fragile skin, and bleeding problems. Learn more: ow.ly/uq5Z50OzKgg
person pushing thumb down to touch the same forearm
5
Quote Tweet
La Crosse encephalitis is rare, but deadly. It occurs most often in children younger than 16 years old. Keep your family safe by using EPA-registered insect repellent and removing standing water near your home where mosquitoes lay eggs. Learn more: bit.ly/3VOEr7j
Embedded video
1:08
8.3K views
Men, are you at risk for prostate cancer? •African American •over age 60 •have a father or brother with prostate cancer •eat a diet high in fat, especially animal fat •obese Learn more about diagnosis and treatments: ow.ly/Krxg50OuUmf
Biomedical illustration of a prostate.
5
Night blindness may cause problems with driving at night. People with night blindness often have trouble seeing stars on a clear night or walking through a dark room, such as a movie theater. Learn more: ow.ly/yVTz50OuTQL
 Car headlights shining in the  night.
7
Quote Tweet
Tag, you’re it! Activities such as chase, hide-and-seek, kickball, and duck, duck, goose are fun games to get young children involved in physical activity early. Encourage kids to #BeActive and stay active with these tips: bit.ly/3MIm9Sf. #MoveInMay #CDCChronic
Image
3
Genetics can play a role in the severity of a person's reaction to Lyme disease, particularly whether they'll develop a complication called antibiotic-refractory Lyme arthritis. To learn more about genetic factors in Lyme disease, check out ow.ly/JlKa50OtoLY
Triangular warning sign about ticks on a tree in the woods.
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG In the HTT gene, 3 DNA building blocks—CAG—are normally repeated 10 to 35 times. Just 1 more time can cause Huntington's disease. Read why: ow.ly/J25c50Otm8n
Short segment of HTT gene showing 3-nucleotide sets. CAG is repeated several times.  Arrow leads to the protein sequence with several glutamine protein building blocks. Inset box explaining that an abnormal protein with 36 or more glutamines causes Huntington's disease.
2
Celiac disease is an immune disease in which people can't eat gluten because it will damage their small intestine. Gluten is a protein found in wheat, rye, and barley. Blood tests can help your doctor diagnose the disease. Learn more: ow.ly/Tg8m50OlPmG
Image
2